crispr library plasmids dna Search Results


90
OriGene human tmem30a cdna
<t> Human TMEM30a </t> partially reconstitutes phospholipid import in ⊗Lem3 S. cerevisiae
Human Tmem30a Cdna, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+library+plasmids+dna/Human+Transmembrane+protein+30A+(TMEM30A)+activation+kit+by+CRISPRa/pmc03073457-100-0-6
Average 90 stars, based on 1 article reviews
human tmem30a cdna - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

96
Oxford Nanopore rapid barcoding kit
Schematic representation of mechanistic strategies of <t>barcoding.</t> (A–C) Barcodes can be introduced to a template using adaptors through direct ligation (A) , using RT- or PCR primers at the reverse transcription or PCR amplification step (B) , and using hybridizing molecular inversion probes (C) . (D) Schematic representation of the difference between “barcodes” and “sample indexes”. Barcodes aim to correct sequencing errors. For example, a misreading nucleotide, guanosine (G) can be corrected in final consensus sequences for a pool of Sample 1 (top panel). Sample indexes are used to multiplex different sequencing amplicons generated from different pools of samples (Sample 1, 2, and 3) (bottom panel). Panel (A) is modified based on in and panel (C) is modified based on in .
Rapid Barcoding Kit, supplied by Oxford Nanopore, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+library+plasmids+dna/Rapid+barcoding+sequencing+kit/pmc10366608-0-26-24
Average 96 stars, based on 1 article reviews
rapid barcoding kit - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

99
New England Biolabs p8107s cas9 nuclease neb
Schematic representation of mechanistic strategies of <t>barcoding.</t> (A–C) Barcodes can be introduced to a template using adaptors through direct ligation (A) , using RT- or PCR primers at the reverse transcription or PCR amplification step (B) , and using hybridizing molecular inversion probes (C) . (D) Schematic representation of the difference between “barcodes” and “sample indexes”. Barcodes aim to correct sequencing errors. For example, a misreading nucleotide, guanosine (G) can be corrected in final consensus sequences for a pool of Sample 1 (top panel). Sample indexes are used to multiplex different sequencing amplicons generated from different pools of samples (Sample 1, 2, and 3) (bottom panel). Panel (A) is modified based on in and panel (C) is modified based on in .
P8107s Cas9 Nuclease Neb, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+library+plasmids+dna/Proteinase+K/pm33421369-416-210-213
Average 99 stars, based on 1 article reviews
p8107s cas9 nuclease neb - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

97
New England Biolabs phusion hot start flex dna polymerase
Schematic representation of mechanistic strategies of <t>barcoding.</t> (A–C) Barcodes can be introduced to a template using adaptors through direct ligation (A) , using RT- or PCR primers at the reverse transcription or PCR amplification step (B) , and using hybridizing molecular inversion probes (C) . (D) Schematic representation of the difference between “barcodes” and “sample indexes”. Barcodes aim to correct sequencing errors. For example, a misreading nucleotide, guanosine (G) can be corrected in final consensus sequences for a pool of Sample 1 (top panel). Sample indexes are used to multiplex different sequencing amplicons generated from different pools of samples (Sample 1, 2, and 3) (bottom panel). Panel (A) is modified based on in and panel (C) is modified based on in .
Phusion Hot Start Flex Dna Polymerase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+library+plasmids+dna/Phusion+Hot+Start+Flex+DNA+Polymerase/pm34791209-64-28-34
Average 97 stars, based on 1 article reviews
phusion hot start flex dna polymerase - by Bioz Stars, 2026-08
97/100 stars
  Buy from Supplier

98
New England Biolabs dna polymerases
See also . A. Location of R337 in the crystal structures of swap dimeric and non-swap monomeric FoxP3. R337 interacts with <t>DNA</t> and Y373 only in the non-swap conformation. B. Abnormal immune homeostasis in 8-week-old R337Q male mice, generated by <t>CRISPR</t> <t>mutagenesis</t> of Foxp3 . Bottom left: a representative picture comparing the spleens and inguinal lymph nodes of R337Q mutant mice and their WT littermates. Bottom right: spleen weights. C. Fraction of activated (CD44 + ) conventional T (Tconv) cells among CD4 + T cells in the spleen and the colonic lamina propria of WT and R337Q mutant mice. D. Foxp3 + Treg in the spleen and the colonic lamina propria of R337Q mutant mice in comparison to their WT littermates. Left: their fraction among TCR β + CD4 + T cells. Right: their activation status assessed by the marker CD44 + . E. CD25/FoxP3 cytometry plots of spleen TCR β + CD4 + T cells from WT and R337Q mutant mice. F. Quantification of CD25, CTLA4 and FoxP3 by flow cytometry (MFI) in TCR β + CD4 + Foxp3 + spleen Tregs of R337Q mutant mice and WT littermates. G. SEC-MALS of NusA-tagged FoxP3 RBR-forkhead (WT, R337Q and R337Q+A372S) H. DNA binding activity of recombinant, purified FoxP3 RBR-forkhead (WT, R337Q and R337Q+A372S) as measured by EMSA. FoxP3 was tagged with NusA. DNA harbors IR-FKHM 4g . I. Runx1 binding for full-length FoxP3 (WT, R337Q and R337Q+A372S) from 293T cells. J. Transcriptional activity of FoxP3 as measured by CD25 and CTLA4 levels. The effects of R337Q, either alone or in combination with the swap-suppressive mutation A372S, were examined. Data in (B-D, F) are presented as mean ± SEM. P values were obtained by Mann-Whitney test comparing WT and R337Q .. Data in (G-J) are representative of at least three independent experiments.
Dna Polymerases, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+library+plasmids+dna/DNA+Polymerase+I%2C+Large+(Klenow)+Fragment/bio_rxiv__2022__02__08__479534-252-25-22
Average 98 stars, based on 1 article reviews
dna polymerases - by Bioz Stars, 2026-08
98/100 stars
  Buy from Supplier

99
Zymo Research dna clean concentrator 5 zymo
See also . A. Location of R337 in the crystal structures of swap dimeric and non-swap monomeric FoxP3. R337 interacts with <t>DNA</t> and Y373 only in the non-swap conformation. B. Abnormal immune homeostasis in 8-week-old R337Q male mice, generated by <t>CRISPR</t> <t>mutagenesis</t> of Foxp3 . Bottom left: a representative picture comparing the spleens and inguinal lymph nodes of R337Q mutant mice and their WT littermates. Bottom right: spleen weights. C. Fraction of activated (CD44 + ) conventional T (Tconv) cells among CD4 + T cells in the spleen and the colonic lamina propria of WT and R337Q mutant mice. D. Foxp3 + Treg in the spleen and the colonic lamina propria of R337Q mutant mice in comparison to their WT littermates. Left: their fraction among TCR β + CD4 + T cells. Right: their activation status assessed by the marker CD44 + . E. CD25/FoxP3 cytometry plots of spleen TCR β + CD4 + T cells from WT and R337Q mutant mice. F. Quantification of CD25, CTLA4 and FoxP3 by flow cytometry (MFI) in TCR β + CD4 + Foxp3 + spleen Tregs of R337Q mutant mice and WT littermates. G. SEC-MALS of NusA-tagged FoxP3 RBR-forkhead (WT, R337Q and R337Q+A372S) H. DNA binding activity of recombinant, purified FoxP3 RBR-forkhead (WT, R337Q and R337Q+A372S) as measured by EMSA. FoxP3 was tagged with NusA. DNA harbors IR-FKHM 4g . I. Runx1 binding for full-length FoxP3 (WT, R337Q and R337Q+A372S) from 293T cells. J. Transcriptional activity of FoxP3 as measured by CD25 and CTLA4 levels. The effects of R337Q, either alone or in combination with the swap-suppressive mutation A372S, were examined. Data in (B-D, F) are presented as mean ± SEM. P values were obtained by Mann-Whitney test comparing WT and R337Q .. Data in (G-J) are representative of at least three independent experiments.
Dna Clean Concentrator 5 Zymo, supplied by Zymo Research, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+library+plasmids+dna/DNA+Clean+%26+Concentrator-5/pm38262408-911-83-87
Average 99 stars, based on 1 article reviews
dna clean concentrator 5 zymo - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

99
Zymo Research ez dna methylation gold kit
Dynamics of <t>DNA</t> <t>methylation</t> (5mC) and mRNA m 6 A methylation in tomato fruit ripening. a Images of wild-type (WT) fruit at different ripening stages and Cnr fruit at 42 DPA. DPA, days post-anthesis; scale bar = 1 cm. b Relative 5mC levels of WT and Cnr fruit shown in a . For 5mC assay, 100 ng of genomic DNA was detected in each sample by MethylFlash™ methylated DNA quantification kit. 5mC level in each sample was normalized to that of the positive control according to the manufacturer’s instructions. The plus sign represents the average in each box. c LC-MS/MS assay showing the amount of mRNA m 6 A in WT and Cnr fruit shown in a . Data are presented as mean ± standard deviation ( n = 3). Asterisks indicate significant differences (* P < 0.05, ** P < 0.01; Student’s t test). NS, no significance
Ez Dna Methylation Gold Kit, supplied by Zymo Research, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+library+plasmids+dna/EZ+DNA+Methylation-Gold+Kit/pmc06683476-367-32-36
Average 99 stars, based on 1 article reviews
ez dna methylation gold kit - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

97
Miltenyi Biotec cd34 microbead kit
(A) Indels by amplicon deep sequencing in sorted HSPCs <t>(hCD45+CD34+),</t> promyelocytes (hCD45+CD33lowSSChighCD117+) and neutrophils (hCD45+CD33lowSSChighCD16+) from engrafted mouse BM (n = 3 mice from donor 1).
Cd34 Microbead Kit, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+library+plasmids+dna/CD34+MicroBead+Kit%2C+human/pmc08106646-33-0-4
Average 97 stars, based on 1 article reviews
cd34 microbead kit - by Bioz Stars, 2026-08
97/100 stars
  Buy from Supplier

99
Thermo Fisher crispr plasmid dna
(A) Indels by amplicon deep sequencing in sorted HSPCs <t>(hCD45+CD34+),</t> promyelocytes (hCD45+CD33lowSSChighCD117+) and neutrophils (hCD45+CD33lowSSChighCD16+) from engrafted mouse BM (n = 3 mice from donor 1).
Crispr Plasmid Dna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+library+plasmids+dna/DNA/pmc06320285-346-15-21
Average 99 stars, based on 1 article reviews
crispr plasmid dna - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

99
Transnetyx genotyping
(A) Indels by amplicon deep sequencing in sorted HSPCs <t>(hCD45+CD34+),</t> promyelocytes (hCD45+CD33lowSSChighCD117+) and neutrophils (hCD45+CD33lowSSChighCD16+) from engrafted mouse BM (n = 3 mice from donor 1).
Genotyping, supplied by Transnetyx, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+library+plasmids+dna/Automated+Genotyping/pmc08568944-206-10-11
Average 99 stars, based on 1 article reviews
genotyping - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

90
OriGene mouse slx4
<t>SLX1/SLX4</t> contribute to fragile telomere formation in Blm-deficient cells. (A) Western blot analysis of BLM in BlmF/F MEFs ± Cre (96 h). γ-Tubulin serves as the loading control. (B) Telomere FISH on metaphase spreads of BlmF/F MEFs ± Cre (96 h) with Cy3-[CCCTAA]3 probes (green) and DAPI staining (red). Fragile telomeres are marked by an asterisk. (C) Knockdown of ZRANB3, SMARCAL1, and HTLF with shRNAs (6 d) in BlmF/F MEFs verified by Western blotting. Cells infected with an shRNA targeting Luciferase (shLuc) were used as the control. γ-Tubulin serves as the loading control and an asterisk marks a nonspecific band detected by the HLTF antibody. (D) Quantification of fragile telomeres detected by FISH (q arms only) in BlmF/F MEFs ± Cre (96 h) with shRNAs targeting Luc, ZRANB3, SMARCAL1, or HTLF as described in C. (E) Quantification of q arm fragile telomeres detected by FISH in BlmF/F MEFs ± Cre (96 h) after CRISPR/Cas9 targeting of Slx4 with three different sgRNAs. Control cells were infected with an sgRNA targeting Luciferase (sgLuc). The relative level of SLX4 mRNA normalized to GAPDH was determined by RT-qPCR and compared with the sgLuc sample (set to 100). (F) Western blot analysis of SLX1 after CRISPR/Cas9 targeting of Slx1 with three different sgRNAs. γ-Tubulin serves as the loading control. (G) Quantification of q arm fragile telomeres detected by FISH in BlmF/F MEFs ± Cre (96 h) after CRISPR/Cas9 targeting of Slx1 with three different sgRNAs as in F. (H) Western blot analysis of the expression of FLAG-SLX4 and various mutants in BlmF/F MEFs with γ-Tubulin as the loading control. (I) Quantification of q arm fragile telomeres detected by FISH in BlmF/F MEFs + Cre (96 h) expressing empty vector (−), sgRNA-resistant WT FLAG-SLX4 or various mutants with CRISPR/Cas9 targeting of Luc or Slx4. (J) PLA foci (red) of TRF1 and γH2AX detected in BlmF/F MEFs ± Cre (96 h). (K) Quantification of PLA foci as in J in BlmF/F MEFs ± Cre (96 h) with CRISPR/Cas9 targeting of Luc, Slx4, or Slx1. Data are means ± SD of four independent experiments of >100 nuclei each. P-values were from paired two-tailed t-tests. (*) P ≤ 0.05. (L) PLA foci (red) of FLAG-TRF1 and 53BP1 detected in BlmF/F MEFs ± Cre (96 h). (M) Quantification of FLAG-TRF1/53BP1 PLA foci in BlmF/F MEFs ± Cre (96 h) with CRISPR/Cas9 targeting of Luc, Slx4, or Slx1. Data are means ± SD of three independent experiments of >100 nuclei each. For the fragile telomere analyses in D, E, G, and I, data are means ± SD from three independent experiments with ∼2000 telomeres analyzed per experiment. All P-values except for the ones in K were derived from unpaired two-tailed t-tests. (***) P ≤ 0.001, (**) P ≤ 0.01, (*) P ≤ 0.05, (n.s.) P > 0.05.
Mouse Slx4, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+library+plasmids+dna/SOX10+(BC002824)+Human+Untagged+Clone/pmc07528700-359-0-8
Average 90 stars, based on 1 article reviews
mouse slx4 - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

94
Thermo Fisher gene exp ahrr hs01005075 m1
Primers used for DNA methylation analysis.
Gene Exp Ahrr Hs01005075 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+library+plasmids+dna/Gene+Exp%2E+AHRR%2C+Hs01005075_m1/pmc09656229-20-2--1
Average 94 stars, based on 1 article reviews
gene exp ahrr hs01005075 m1 - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

Image Search Results


 Human TMEM30a  partially reconstitutes phospholipid import in ⊗Lem3 S. cerevisiae

Journal:

Article Title: Human TMEM30a Promotes Uptake of Anti-tumor and Bioactive Choline Phospholipids into Mammalian Cells 1

doi: 10.4049/jimmunol.1002710

Figure Lengend Snippet: Human TMEM30a partially reconstitutes phospholipid import in ⊗Lem3 S. cerevisiae

Article Snippet: Human TMEM30a cDNA was purchased from Origene Technologies (Rockville, MD), and shRNA plasmids against human TMEM30a were from SuperArray Bioscience (Frederick, MD).

Techniques:

(A) ΔLem3 S. cerevisiae transformed with empty vector or two isolates transformed with human TMEM30a were grown on glucose or galactose to induce TMEM30a expression. NBD-phosphatidylcholine uptake was determined by flow cytometry. (B) Concentration dependent effect of Edelfosine on colony growth of serially diluted wild-type S. cerevisiae or ΔLem3 transformed with empty vector or two ΔLem3 isolates transformed with human TMEM30a.

Journal:

Article Title: Human TMEM30a Promotes Uptake of Anti-tumor and Bioactive Choline Phospholipids into Mammalian Cells 1

doi: 10.4049/jimmunol.1002710

Figure Lengend Snippet: (A) ΔLem3 S. cerevisiae transformed with empty vector or two isolates transformed with human TMEM30a were grown on glucose or galactose to induce TMEM30a expression. NBD-phosphatidylcholine uptake was determined by flow cytometry. (B) Concentration dependent effect of Edelfosine on colony growth of serially diluted wild-type S. cerevisiae or ΔLem3 transformed with empty vector or two ΔLem3 isolates transformed with human TMEM30a.

Article Snippet: Human TMEM30a cDNA was purchased from Origene Technologies (Rockville, MD), and shRNA plasmids against human TMEM30a were from SuperArray Bioscience (Frederick, MD).

Techniques: Transformation Assay, Plasmid Preparation, Expressing, Flow Cytometry, Concentration Assay

(A) NBD-phosphatidylcholine uptake determined by flow cytometry for wild-type S. cerevisiae transformed with empty vector or ΔLem3 transformed with Lem3, TMEM30a or a chimera (Table 1) of Lem3 and TMEM30a. (B) Quantitation (n=3) of NBD-phosphatidylcholine uptake by ΔLem3 transformed with Lem3-TMEM30a (LT; see Table 1 for sequence), TMEM30a-Lem3 (TL), or TMEM30a-Lem3-TMEM30a (TLT) chimeras. Western blot (top) for V5 antigen contained in sequences encoding TMEM30a and its chimeras isolated from protein extracts of S. cerevisiae grown in galactose to induce insert expression or non-inducing glucose. (C) Concentration dependent effect of Edelfosine on colony formation on glucose or galactose plates for wild-type S. cerevisiae or ΔLem3 transformed with galactose induced human, yeast or chimeric constructs. (D) Effect of Edelfosine on ΔLem3 viability after introduction of human TMEM30a, yeast Lem3p, or chimeras formed from them. Cell number (OD600) in liquid culture of wildtype or ΔLem3 transformed with the stated vectors at defined concentrations (left) or 12.5 μg/ml (right).

Journal:

Article Title: Human TMEM30a Promotes Uptake of Anti-tumor and Bioactive Choline Phospholipids into Mammalian Cells 1

doi: 10.4049/jimmunol.1002710

Figure Lengend Snippet: (A) NBD-phosphatidylcholine uptake determined by flow cytometry for wild-type S. cerevisiae transformed with empty vector or ΔLem3 transformed with Lem3, TMEM30a or a chimera (Table 1) of Lem3 and TMEM30a. (B) Quantitation (n=3) of NBD-phosphatidylcholine uptake by ΔLem3 transformed with Lem3-TMEM30a (LT; see Table 1 for sequence), TMEM30a-Lem3 (TL), or TMEM30a-Lem3-TMEM30a (TLT) chimeras. Western blot (top) for V5 antigen contained in sequences encoding TMEM30a and its chimeras isolated from protein extracts of S. cerevisiae grown in galactose to induce insert expression or non-inducing glucose. (C) Concentration dependent effect of Edelfosine on colony formation on glucose or galactose plates for wild-type S. cerevisiae or ΔLem3 transformed with galactose induced human, yeast or chimeric constructs. (D) Effect of Edelfosine on ΔLem3 viability after introduction of human TMEM30a, yeast Lem3p, or chimeras formed from them. Cell number (OD600) in liquid culture of wildtype or ΔLem3 transformed with the stated vectors at defined concentrations (left) or 12.5 μg/ml (right).

Article Snippet: Human TMEM30a cDNA was purchased from Origene Technologies (Rockville, MD), and shRNA plasmids against human TMEM30a were from SuperArray Bioscience (Frederick, MD).

Techniques: Flow Cytometry, Transformation Assay, Plasmid Preparation, Quantitation Assay, Sequencing, Western Blot, Isolation, Expressing, Concentration Assay, Construct

(A) CHO cells stably transfected with TMEM30a-GFP and then stained with CellMask™ Orange Plasma Membrane to mark the plasma membrane (top) then imaged by confocal microscopy. Co-expression of the appropriate orange fluorescent protein Organelle Light defined endoplasmic reticulum (row 2), or Golgi (row 3). TMEM30a-GFP expressing CHO cells were labeled with MitoTracker Red to identify polarized mitochondria (bottom). (B) Western blot for GFP or plasma membrane Na/K ATPase in density gradient fractions from HepG2 cells stably expressing TMEM30a-GFP. (C) Fluorescent intensity of TMEM30a-Jurkat cells during flow cytometry after 10 min incubation in the presence of NBD-phosphatidylcholine (1 μM) alone or additionally with 5 μM Az-LPAF or Edelfosine.

Journal:

Article Title: Human TMEM30a Promotes Uptake of Anti-tumor and Bioactive Choline Phospholipids into Mammalian Cells 1

doi: 10.4049/jimmunol.1002710

Figure Lengend Snippet: (A) CHO cells stably transfected with TMEM30a-GFP and then stained with CellMask™ Orange Plasma Membrane to mark the plasma membrane (top) then imaged by confocal microscopy. Co-expression of the appropriate orange fluorescent protein Organelle Light defined endoplasmic reticulum (row 2), or Golgi (row 3). TMEM30a-GFP expressing CHO cells were labeled with MitoTracker Red to identify polarized mitochondria (bottom). (B) Western blot for GFP or plasma membrane Na/K ATPase in density gradient fractions from HepG2 cells stably expressing TMEM30a-GFP. (C) Fluorescent intensity of TMEM30a-Jurkat cells during flow cytometry after 10 min incubation in the presence of NBD-phosphatidylcholine (1 μM) alone or additionally with 5 μM Az-LPAF or Edelfosine.

Article Snippet: Human TMEM30a cDNA was purchased from Origene Technologies (Rockville, MD), and shRNA plasmids against human TMEM30a were from SuperArray Bioscience (Frederick, MD).

Techniques: Stable Transfection, Transfection, Staining, Confocal Microscopy, Expressing, Labeling, Western Blot, Flow Cytometry, Incubation

(A) NBD-phosphatidylcholine uptake by CHO cells transfected with empty vector or a TMEM30a vector assessed by confocal microscopy (40X). Inset, 60X. (B) Uptake of [3H]PAF by CHO cells expressing TMEM30a containing a GFP or Lumio tag (n=3). (C) Phosphatidylserine surface expression is not reduced in TMEM30a transfected CHO cells. Surface phosphatidylserine was detected (n=3) by flow cytometry with annexin V conjugated with Alexa647 as described in “Methods.”

Journal:

Article Title: Human TMEM30a Promotes Uptake of Anti-tumor and Bioactive Choline Phospholipids into Mammalian Cells 1

doi: 10.4049/jimmunol.1002710

Figure Lengend Snippet: (A) NBD-phosphatidylcholine uptake by CHO cells transfected with empty vector or a TMEM30a vector assessed by confocal microscopy (40X). Inset, 60X. (B) Uptake of [3H]PAF by CHO cells expressing TMEM30a containing a GFP or Lumio tag (n=3). (C) Phosphatidylserine surface expression is not reduced in TMEM30a transfected CHO cells. Surface phosphatidylserine was detected (n=3) by flow cytometry with annexin V conjugated with Alexa647 as described in “Methods.”

Article Snippet: Human TMEM30a cDNA was purchased from Origene Technologies (Rockville, MD), and shRNA plasmids against human TMEM30a were from SuperArray Bioscience (Frederick, MD).

Techniques: Transfection, Plasmid Preparation, Confocal Microscopy, Expressing, Flow Cytometry

(A) Quantitative PCR for TMEM30a mRNA after transfection by empty vector or one containing TMEM30a shRNA (n=3). (B) Jurkat viability to Edelfosine exposure after transfection with an empty vector or TMEM30a shRNA (n=3). (C) Jurkat cell uptake of fluorescent NBD-phosphatidylcholine (upper) or NBD-phosphatidylethanolamine (lower) by cells expressing TMEM30a shRNA or its vector (n=3). (D) Quantitation of NBD-phosphatidylcholine accumulation by Jurkat cells expressing TMEM30a shRNA or empty vector (n=3). (E) Uptake of [3H]PAF by Jurkat cells is reduced by TMEM30a shRNA knockdown (n=4). All quantitative measures used triplicate determinations in each experiment.

Journal:

Article Title: Human TMEM30a Promotes Uptake of Anti-tumor and Bioactive Choline Phospholipids into Mammalian Cells 1

doi: 10.4049/jimmunol.1002710

Figure Lengend Snippet: (A) Quantitative PCR for TMEM30a mRNA after transfection by empty vector or one containing TMEM30a shRNA (n=3). (B) Jurkat viability to Edelfosine exposure after transfection with an empty vector or TMEM30a shRNA (n=3). (C) Jurkat cell uptake of fluorescent NBD-phosphatidylcholine (upper) or NBD-phosphatidylethanolamine (lower) by cells expressing TMEM30a shRNA or its vector (n=3). (D) Quantitation of NBD-phosphatidylcholine accumulation by Jurkat cells expressing TMEM30a shRNA or empty vector (n=3). (E) Uptake of [3H]PAF by Jurkat cells is reduced by TMEM30a shRNA knockdown (n=4). All quantitative measures used triplicate determinations in each experiment.

Article Snippet: Human TMEM30a cDNA was purchased from Origene Technologies (Rockville, MD), and shRNA plasmids against human TMEM30a were from SuperArray Bioscience (Frederick, MD).

Techniques: Real-time Polymerase Chain Reaction, Transfection, Plasmid Preparation, shRNA, Expressing, Quantitation Assay

(A) Flow cytometric analysis of JC-1 green fluorescence (FL1, x axis) and orange/red fluorescence (FL2, y axis) in the presence of the stated azelaoyl lysoPAF concentration in vector and TMEM30a shRNA transfected Jurkat cells. The cationic dye JC1 in functional, polarized mitochondria is aggregated and fluoresces red/orange, while monomeric dye free in the cytoplasm fluoresces green. (B) Flow cytometric analysis of JC-1 fluorescence in the stated concentration of Edelfosine.

Journal:

Article Title: Human TMEM30a Promotes Uptake of Anti-tumor and Bioactive Choline Phospholipids into Mammalian Cells 1

doi: 10.4049/jimmunol.1002710

Figure Lengend Snippet: (A) Flow cytometric analysis of JC-1 green fluorescence (FL1, x axis) and orange/red fluorescence (FL2, y axis) in the presence of the stated azelaoyl lysoPAF concentration in vector and TMEM30a shRNA transfected Jurkat cells. The cationic dye JC1 in functional, polarized mitochondria is aggregated and fluoresces red/orange, while monomeric dye free in the cytoplasm fluoresces green. (B) Flow cytometric analysis of JC-1 fluorescence in the stated concentration of Edelfosine.

Article Snippet: Human TMEM30a cDNA was purchased from Origene Technologies (Rockville, MD), and shRNA plasmids against human TMEM30a were from SuperArray Bioscience (Frederick, MD).

Techniques: Fluorescence, Concentration Assay, Plasmid Preparation, shRNA, Transfection, Functional Assay

Schematic representation of mechanistic strategies of barcoding. (A–C) Barcodes can be introduced to a template using adaptors through direct ligation (A) , using RT- or PCR primers at the reverse transcription or PCR amplification step (B) , and using hybridizing molecular inversion probes (C) . (D) Schematic representation of the difference between “barcodes” and “sample indexes”. Barcodes aim to correct sequencing errors. For example, a misreading nucleotide, guanosine (G) can be corrected in final consensus sequences for a pool of Sample 1 (top panel). Sample indexes are used to multiplex different sequencing amplicons generated from different pools of samples (Sample 1, 2, and 3) (bottom panel). Panel (A) is modified based on in and panel (C) is modified based on in .

Journal: Frontiers in Molecular Biosciences

Article Title: A systematic review of the barcoding strategy that contributes to COVID-19 diagnostics at a population level

doi: 10.3389/fmolb.2023.1141534

Figure Lengend Snippet: Schematic representation of mechanistic strategies of barcoding. (A–C) Barcodes can be introduced to a template using adaptors through direct ligation (A) , using RT- or PCR primers at the reverse transcription or PCR amplification step (B) , and using hybridizing molecular inversion probes (C) . (D) Schematic representation of the difference between “barcodes” and “sample indexes”. Barcodes aim to correct sequencing errors. For example, a misreading nucleotide, guanosine (G) can be corrected in final consensus sequences for a pool of Sample 1 (top panel). Sample indexes are used to multiplex different sequencing amplicons generated from different pools of samples (Sample 1, 2, and 3) (bottom panel). Panel (A) is modified based on in and panel (C) is modified based on in .

Article Snippet: Primer-associated approach , Sequence-based barcodes , SQK-RBK004: transposase carrying barcodes to the site of the cleavage , - , - , Whole genome , Oxford Nanopore Rapid Barcoding kit (SQK-RBK004) , SARS-CoV-2 patient samples (nasopharyngeal swab) , Oxford Nanopore , Guppy version 3.6.0; ARTIC Network bioinformatics protocol , Multiplex samples , Propose a method to sequence the whole genome of SARS-CoV-2 in a rapid and cost-efficient manner , .

Techniques: Ligation, Reverse Transcription, Amplification, Sequencing, Multiplex Assay, Generated, Modification

Systematic comparison of  barcoding  strategies used in the category of molecular barcodes.

Journal: Frontiers in Molecular Biosciences

Article Title: A systematic review of the barcoding strategy that contributes to COVID-19 diagnostics at a population level

doi: 10.3389/fmolb.2023.1141534

Figure Lengend Snippet: Systematic comparison of barcoding strategies used in the category of molecular barcodes.

Article Snippet: Primer-associated approach , Sequence-based barcodes , SQK-RBK004: transposase carrying barcodes to the site of the cleavage , - , - , Whole genome , Oxford Nanopore Rapid Barcoding kit (SQK-RBK004) , SARS-CoV-2 patient samples (nasopharyngeal swab) , Oxford Nanopore , Guppy version 3.6.0; ARTIC Network bioinformatics protocol , Multiplex samples , Propose a method to sequence the whole genome of SARS-CoV-2 in a rapid and cost-efficient manner , .

Techniques: Comparison, Software, Sequencing, Multiplex Assay, CRISPR, Plasmid Preparation, Microarray, Binding Assay, Amplification, Extraction, Ligation, DNA Sequencing, Multiplexing, Generated, Reverse Transcription, Staining, Flow Cytometry, High Throughput Screening Assay, Inhibition, Blocking Assay, Conjugation Assay, RNA Sequencing Assay, Transmission Assay, Incubation, Diagnostic Assay, Next-Generation Sequencing, Infection

See also . A. Location of R337 in the crystal structures of swap dimeric and non-swap monomeric FoxP3. R337 interacts with DNA and Y373 only in the non-swap conformation. B. Abnormal immune homeostasis in 8-week-old R337Q male mice, generated by CRISPR mutagenesis of Foxp3 . Bottom left: a representative picture comparing the spleens and inguinal lymph nodes of R337Q mutant mice and their WT littermates. Bottom right: spleen weights. C. Fraction of activated (CD44 + ) conventional T (Tconv) cells among CD4 + T cells in the spleen and the colonic lamina propria of WT and R337Q mutant mice. D. Foxp3 + Treg in the spleen and the colonic lamina propria of R337Q mutant mice in comparison to their WT littermates. Left: their fraction among TCR β + CD4 + T cells. Right: their activation status assessed by the marker CD44 + . E. CD25/FoxP3 cytometry plots of spleen TCR β + CD4 + T cells from WT and R337Q mutant mice. F. Quantification of CD25, CTLA4 and FoxP3 by flow cytometry (MFI) in TCR β + CD4 + Foxp3 + spleen Tregs of R337Q mutant mice and WT littermates. G. SEC-MALS of NusA-tagged FoxP3 RBR-forkhead (WT, R337Q and R337Q+A372S) H. DNA binding activity of recombinant, purified FoxP3 RBR-forkhead (WT, R337Q and R337Q+A372S) as measured by EMSA. FoxP3 was tagged with NusA. DNA harbors IR-FKHM 4g . I. Runx1 binding for full-length FoxP3 (WT, R337Q and R337Q+A372S) from 293T cells. J. Transcriptional activity of FoxP3 as measured by CD25 and CTLA4 levels. The effects of R337Q, either alone or in combination with the swap-suppressive mutation A372S, were examined. Data in (B-D, F) are presented as mean ± SEM. P values were obtained by Mann-Whitney test comparing WT and R337Q .. Data in (G-J) are representative of at least three independent experiments.

Journal: bioRxiv

Article Title: FoxP3 can fold into two distinct dimerization states with divergent functional implications for T cell homeostasis

doi: 10.1101/2022.02.08.479534

Figure Lengend Snippet: See also . A. Location of R337 in the crystal structures of swap dimeric and non-swap monomeric FoxP3. R337 interacts with DNA and Y373 only in the non-swap conformation. B. Abnormal immune homeostasis in 8-week-old R337Q male mice, generated by CRISPR mutagenesis of Foxp3 . Bottom left: a representative picture comparing the spleens and inguinal lymph nodes of R337Q mutant mice and their WT littermates. Bottom right: spleen weights. C. Fraction of activated (CD44 + ) conventional T (Tconv) cells among CD4 + T cells in the spleen and the colonic lamina propria of WT and R337Q mutant mice. D. Foxp3 + Treg in the spleen and the colonic lamina propria of R337Q mutant mice in comparison to their WT littermates. Left: their fraction among TCR β + CD4 + T cells. Right: their activation status assessed by the marker CD44 + . E. CD25/FoxP3 cytometry plots of spleen TCR β + CD4 + T cells from WT and R337Q mutant mice. F. Quantification of CD25, CTLA4 and FoxP3 by flow cytometry (MFI) in TCR β + CD4 + Foxp3 + spleen Tregs of R337Q mutant mice and WT littermates. G. SEC-MALS of NusA-tagged FoxP3 RBR-forkhead (WT, R337Q and R337Q+A372S) H. DNA binding activity of recombinant, purified FoxP3 RBR-forkhead (WT, R337Q and R337Q+A372S) as measured by EMSA. FoxP3 was tagged with NusA. DNA harbors IR-FKHM 4g . I. Runx1 binding for full-length FoxP3 (WT, R337Q and R337Q+A372S) from 293T cells. J. Transcriptional activity of FoxP3 as measured by CD25 and CTLA4 levels. The effects of R337Q, either alone or in combination with the swap-suppressive mutation A372S, were examined. Data in (B-D, F) are presented as mean ± SEM. P values were obtained by Mann-Whitney test comparing WT and R337Q .. Data in (G-J) are representative of at least three independent experiments.

Article Snippet: All FoxP3 mutations including F325D, F331D, K332D, H334D, R337Q, R347H, W348D and R337Q/A372S were generated by site-directed mutagenesis using Phusion High Fidelity (New England Biolabs) DNA polymerases.

Techniques: Generated, CRISPR, Mutagenesis, Activation Assay, Marker, Cytometry, Flow Cytometry, Binding Assay, Activity Assay, Recombinant, Purification, MANN-WHITNEY

Dynamics of DNA methylation (5mC) and mRNA m 6 A methylation in tomato fruit ripening. a Images of wild-type (WT) fruit at different ripening stages and Cnr fruit at 42 DPA. DPA, days post-anthesis; scale bar = 1 cm. b Relative 5mC levels of WT and Cnr fruit shown in a . For 5mC assay, 100 ng of genomic DNA was detected in each sample by MethylFlash™ methylated DNA quantification kit. 5mC level in each sample was normalized to that of the positive control according to the manufacturer’s instructions. The plus sign represents the average in each box. c LC-MS/MS assay showing the amount of mRNA m 6 A in WT and Cnr fruit shown in a . Data are presented as mean ± standard deviation ( n = 3). Asterisks indicate significant differences (* P < 0.05, ** P < 0.01; Student’s t test). NS, no significance

Journal: Genome Biology

Article Title: RNA methylomes reveal the m 6 A-mediated regulation of DNA demethylase gene SlDML2 in tomato fruit ripening

doi: 10.1186/s13059-019-1771-7

Figure Lengend Snippet: Dynamics of DNA methylation (5mC) and mRNA m 6 A methylation in tomato fruit ripening. a Images of wild-type (WT) fruit at different ripening stages and Cnr fruit at 42 DPA. DPA, days post-anthesis; scale bar = 1 cm. b Relative 5mC levels of WT and Cnr fruit shown in a . For 5mC assay, 100 ng of genomic DNA was detected in each sample by MethylFlash™ methylated DNA quantification kit. 5mC level in each sample was normalized to that of the positive control according to the manufacturer’s instructions. The plus sign represents the average in each box. c LC-MS/MS assay showing the amount of mRNA m 6 A in WT and Cnr fruit shown in a . Data are presented as mean ± standard deviation ( n = 3). Asterisks indicate significant differences (* P < 0.05, ** P < 0.01; Student’s t test). NS, no significance

Article Snippet: In brief, genomic DNA was extracted from the agroinfiltrated N. benthamiana leaves, and 500 ng of purified DNA was treated with bisulfite to produce mutations from cytosine (C) to thymine (T) using EZ DNA methylation-gold kit (ZYMO Research, D5005).

Techniques: DNA Methylation Assay, Methylation, Positive Control, Liquid Chromatography with Mass Spectroscopy, Standard Deviation

SlALKBH2 is transcriptionally regulated by DNA methylation. a The 5mC levels in the differentially methylated region (DMR) of SlALKBH2 promoter in wild-type (WT) and Cnr mutant fruit based on the Tomato Epigenome Database ( http://ted.bti.cornell.edu/epigenome/ ). b The 5mC levels in the DMR of SlALKBH2 promoter in WT and sldml2 mutant fruit based on the DNA methylome database . a , b The numbers indicate the cytosine positions relative to the start codon. Black represents the methylation frequency of cytosines at the indicated positions. DPA, days post-anthesis. c Schematic of the dual-luciferase system used for promoter activity assay. The SlALKBH2 promoter was cloned into the dual-luciferase reporter vector to activate the expression of firefly luciferase (Fluc). The renilla luciferase (Rluc) driven by the CaMV 35S promoter served as an internal control. LB, left border; RB, right border; Ter, terminator. d – f Co-expression of SlDML2 (SlDML2-HA) with the dual-luciferase reporter vector in the Nicotiana benthamiana leaves increased the relative Fluc activity ( d ), facilitated the Fluc gene expression ( e ), and reduced the 5mC level in SlALKBH2 promoter ( f ) compared with the empty plasmid control (HA). d The representative image from a total of six images (left panel). The Fluc activity was normalized against the Rluc activity, followed by normalization against the control (right panel). Data are presented as means ± standard deviation ( n = 6). Asterisks indicate significant differences (*** P < 0.0001; Student’s t test). e Gene expression was determined by quantitative RT-PCR analysis. Error bars represent the standard deviation of three independent experiments. Asterisks indicate significant differences (* P < 0.05; Student’s t test). f The box plot showing 5mC levels of all cytosines ( n = 41) in the DMR analyzed by Sanger bisulfite sequencing. The plus sign represents the average level in each box

Journal: Genome Biology

Article Title: RNA methylomes reveal the m 6 A-mediated regulation of DNA demethylase gene SlDML2 in tomato fruit ripening

doi: 10.1186/s13059-019-1771-7

Figure Lengend Snippet: SlALKBH2 is transcriptionally regulated by DNA methylation. a The 5mC levels in the differentially methylated region (DMR) of SlALKBH2 promoter in wild-type (WT) and Cnr mutant fruit based on the Tomato Epigenome Database ( http://ted.bti.cornell.edu/epigenome/ ). b The 5mC levels in the DMR of SlALKBH2 promoter in WT and sldml2 mutant fruit based on the DNA methylome database . a , b The numbers indicate the cytosine positions relative to the start codon. Black represents the methylation frequency of cytosines at the indicated positions. DPA, days post-anthesis. c Schematic of the dual-luciferase system used for promoter activity assay. The SlALKBH2 promoter was cloned into the dual-luciferase reporter vector to activate the expression of firefly luciferase (Fluc). The renilla luciferase (Rluc) driven by the CaMV 35S promoter served as an internal control. LB, left border; RB, right border; Ter, terminator. d – f Co-expression of SlDML2 (SlDML2-HA) with the dual-luciferase reporter vector in the Nicotiana benthamiana leaves increased the relative Fluc activity ( d ), facilitated the Fluc gene expression ( e ), and reduced the 5mC level in SlALKBH2 promoter ( f ) compared with the empty plasmid control (HA). d The representative image from a total of six images (left panel). The Fluc activity was normalized against the Rluc activity, followed by normalization against the control (right panel). Data are presented as means ± standard deviation ( n = 6). Asterisks indicate significant differences (*** P < 0.0001; Student’s t test). e Gene expression was determined by quantitative RT-PCR analysis. Error bars represent the standard deviation of three independent experiments. Asterisks indicate significant differences (* P < 0.05; Student’s t test). f The box plot showing 5mC levels of all cytosines ( n = 41) in the DMR analyzed by Sanger bisulfite sequencing. The plus sign represents the average level in each box

Article Snippet: In brief, genomic DNA was extracted from the agroinfiltrated N. benthamiana leaves, and 500 ng of purified DNA was treated with bisulfite to produce mutations from cytosine (C) to thymine (T) using EZ DNA methylation-gold kit (ZYMO Research, D5005).

Techniques: DNA Methylation Assay, Methylation, Mutagenesis, Luciferase, Activity Assay, Clone Assay, Plasmid Preparation, Expressing, Standard Deviation, Quantitative RT-PCR, Methylation Sequencing

SlALKBH2 is necessary for normal tomato fruit ripening. a Genotyping of mutations mediated by CRISPR/Cas9 gene-editing system in slalkbh2-23 , slalkbh2-25 , and slalkbh2-28 mutants. Diagram showing the single guide RNAs (sgRNAs) containing different target sequences (T1, T2, and T3), which were designed to specifically target the exons of SlALKBH2 . The red letters indicate the protospacer adjacent motif (PAM). The transgenic plants in the second generation were genotyped by sequencing genomic regions flanking the target sites. Red arrows indicate the editing sites. Two mutants ( slalkbh2-23 and slalkbh2-28 ) have a homozygous 1-bp insertion, and one ( slalkbh2-25 ) has a homozygous 5-bp deletion caused by target T2 in the fourth exon of SlALKBH2 . b Ripening phenotype of slalkbh2 mutants. Fruit from wild-type (WT) and slalkbh2 mutants ( slalkbh2-23 , slalkbh2-25 , and slalkbh2-28 ) at 39, 42, 47, and 52 days post-anthesis (DPA) are shown. c LC-MS/MS assay showing the amount of mRNA m 6 A in WT and slalkbh2 mutant fruit at 39 DPA. Data are presented as mean ± standard deviation ( n = 3). d m 6 A-IP-PCR assay showing the relative m 6 A enrichment in SlDML2 mRNA in WT and slalkbh2 mutant fruit at 39 DPA. e SlDML2 gene expression in WT and slalkbh2 mutant fruit at 39 and 42 DPA. The ACTIN gene was used as an internal control. d , e Error bars represent the standard deviation of three independent experiments. Asterisks indicate significant differences (* P < 0.05, ** P < 0.01; Student’s t test). f Model for the relationship between DNA methylation and m 6 A mRNA methylation in fruit ripening. DNA methylation negatively regulates SlALKBH2 to mediate overall m 6 A mRNA methylation. The m 6 A modification promotes SlDML2 mRNA decay, thereby affecting DNA methylation and fruit ripening

Journal: Genome Biology

Article Title: RNA methylomes reveal the m 6 A-mediated regulation of DNA demethylase gene SlDML2 in tomato fruit ripening

doi: 10.1186/s13059-019-1771-7

Figure Lengend Snippet: SlALKBH2 is necessary for normal tomato fruit ripening. a Genotyping of mutations mediated by CRISPR/Cas9 gene-editing system in slalkbh2-23 , slalkbh2-25 , and slalkbh2-28 mutants. Diagram showing the single guide RNAs (sgRNAs) containing different target sequences (T1, T2, and T3), which were designed to specifically target the exons of SlALKBH2 . The red letters indicate the protospacer adjacent motif (PAM). The transgenic plants in the second generation were genotyped by sequencing genomic regions flanking the target sites. Red arrows indicate the editing sites. Two mutants ( slalkbh2-23 and slalkbh2-28 ) have a homozygous 1-bp insertion, and one ( slalkbh2-25 ) has a homozygous 5-bp deletion caused by target T2 in the fourth exon of SlALKBH2 . b Ripening phenotype of slalkbh2 mutants. Fruit from wild-type (WT) and slalkbh2 mutants ( slalkbh2-23 , slalkbh2-25 , and slalkbh2-28 ) at 39, 42, 47, and 52 days post-anthesis (DPA) are shown. c LC-MS/MS assay showing the amount of mRNA m 6 A in WT and slalkbh2 mutant fruit at 39 DPA. Data are presented as mean ± standard deviation ( n = 3). d m 6 A-IP-PCR assay showing the relative m 6 A enrichment in SlDML2 mRNA in WT and slalkbh2 mutant fruit at 39 DPA. e SlDML2 gene expression in WT and slalkbh2 mutant fruit at 39 and 42 DPA. The ACTIN gene was used as an internal control. d , e Error bars represent the standard deviation of three independent experiments. Asterisks indicate significant differences (* P < 0.05, ** P < 0.01; Student’s t test). f Model for the relationship between DNA methylation and m 6 A mRNA methylation in fruit ripening. DNA methylation negatively regulates SlALKBH2 to mediate overall m 6 A mRNA methylation. The m 6 A modification promotes SlDML2 mRNA decay, thereby affecting DNA methylation and fruit ripening

Article Snippet: In brief, genomic DNA was extracted from the agroinfiltrated N. benthamiana leaves, and 500 ng of purified DNA was treated with bisulfite to produce mutations from cytosine (C) to thymine (T) using EZ DNA methylation-gold kit (ZYMO Research, D5005).

Techniques: CRISPR, Transgenic Assay, Sequencing, Liquid Chromatography with Mass Spectroscopy, Mutagenesis, Standard Deviation, Expressing, DNA Methylation Assay, Methylation, Modification

(A) Indels by amplicon deep sequencing in sorted HSPCs (hCD45+CD34+), promyelocytes (hCD45+CD33lowSSChighCD117+) and neutrophils (hCD45+CD33lowSSChighCD16+) from engrafted mouse BM (n = 3 mice from donor 1).

Journal: Cell stem cell

Article Title: Dissecting ELANE neutropenia pathogenicity by human HSC gene editing

doi: 10.1016/j.stem.2020.12.015

Figure Lengend Snippet: (A) Indels by amplicon deep sequencing in sorted HSPCs (hCD45+CD34+), promyelocytes (hCD45+CD33lowSSChighCD117+) and neutrophils (hCD45+CD33lowSSChighCD16+) from engrafted mouse BM (n = 3 mice from donor 1).

Article Snippet: CD34 MicroBead Kit , Miltenyi Biotec , Cat# 130-046-702.

Techniques: Amplification, Sequencing

(A) Schematic experimental design shows transduction by ELANE targeting lentiviral (LV) sgRNA library and transient infection by ts-rSeV-eGFP-SpCas9, enabling pooled CRISPR screening in primary CD34+ HSPCs. Following high MOI ts-rSeV-eGFP-SpCas9 transient infection and low MOI LV transduction and selection, HSPCs were subject to neutrophil maturation culture and sorted into CD34−CD117−CD16+ (neutrophil enriched) and CD34−CD117+CD16− (promyelocyte enriched) gates prior to genomic DNA isolation and sgRNA sequence library preparation. May-Grunwald-Giemsa stains show indicated sorted populations, scale bars 10 μm.

Journal: Cell stem cell

Article Title: Dissecting ELANE neutropenia pathogenicity by human HSC gene editing

doi: 10.1016/j.stem.2020.12.015

Figure Lengend Snippet: (A) Schematic experimental design shows transduction by ELANE targeting lentiviral (LV) sgRNA library and transient infection by ts-rSeV-eGFP-SpCas9, enabling pooled CRISPR screening in primary CD34+ HSPCs. Following high MOI ts-rSeV-eGFP-SpCas9 transient infection and low MOI LV transduction and selection, HSPCs were subject to neutrophil maturation culture and sorted into CD34−CD117−CD16+ (neutrophil enriched) and CD34−CD117+CD16− (promyelocyte enriched) gates prior to genomic DNA isolation and sgRNA sequence library preparation. May-Grunwald-Giemsa stains show indicated sorted populations, scale bars 10 μm.

Article Snippet: CD34 MicroBead Kit , Miltenyi Biotec , Cat# 130-046-702.

Techniques: Transduction, Infection, CRISPR, Selection, DNA Extraction, Sequencing

(A) Xenograft model of SCN. Human CD34+ HSPCs from three healthy donors edited by Cas9 RNP electroporation (EP) targeting neutral locus, ELANE e2-C71, or e5-R220 infused to NBSGW mice 24 hours after EP. After 16 weeks, engrafted bone marrow was characterized by immunophenotyping, May-Grunwald-Giemsa staining and indel analysis.

Journal: Cell stem cell

Article Title: Dissecting ELANE neutropenia pathogenicity by human HSC gene editing

doi: 10.1016/j.stem.2020.12.015

Figure Lengend Snippet: (A) Xenograft model of SCN. Human CD34+ HSPCs from three healthy donors edited by Cas9 RNP electroporation (EP) targeting neutral locus, ELANE e2-C71, or e5-R220 infused to NBSGW mice 24 hours after EP. After 16 weeks, engrafted bone marrow was characterized by immunophenotyping, May-Grunwald-Giemsa staining and indel analysis.

Article Snippet: CD34 MicroBead Kit , Miltenyi Biotec , Cat# 130-046-702.

Techniques: Electroporation, Staining

(A) Annexin V staining in CD34−CD117−CD16− cells during neutrophil maturation culture after indicated gene editing. Error bars indicate SD (n = 3 technical replicates, representative of 2 biological replicates).

Journal: Cell stem cell

Article Title: Dissecting ELANE neutropenia pathogenicity by human HSC gene editing

doi: 10.1016/j.stem.2020.12.015

Figure Lengend Snippet: (A) Annexin V staining in CD34−CD117−CD16− cells during neutrophil maturation culture after indicated gene editing. Error bars indicate SD (n = 3 technical replicates, representative of 2 biological replicates).

Article Snippet: CD34 MicroBead Kit , Miltenyi Biotec , Cat# 130-046-702.

Techniques: Staining

KEY RESOURCES TABLE

Journal: Cell stem cell

Article Title: Dissecting ELANE neutropenia pathogenicity by human HSC gene editing

doi: 10.1016/j.stem.2020.12.015

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: CD34 MicroBead Kit , Miltenyi Biotec , Cat# 130-046-702.

Techniques: Virus, Recombinant, Sequencing, Amplification, Synthesized, Software

SLX1/SLX4 contribute to fragile telomere formation in Blm-deficient cells. (A) Western blot analysis of BLM in BlmF/F MEFs ± Cre (96 h). γ-Tubulin serves as the loading control. (B) Telomere FISH on metaphase spreads of BlmF/F MEFs ± Cre (96 h) with Cy3-[CCCTAA]3 probes (green) and DAPI staining (red). Fragile telomeres are marked by an asterisk. (C) Knockdown of ZRANB3, SMARCAL1, and HTLF with shRNAs (6 d) in BlmF/F MEFs verified by Western blotting. Cells infected with an shRNA targeting Luciferase (shLuc) were used as the control. γ-Tubulin serves as the loading control and an asterisk marks a nonspecific band detected by the HLTF antibody. (D) Quantification of fragile telomeres detected by FISH (q arms only) in BlmF/F MEFs ± Cre (96 h) with shRNAs targeting Luc, ZRANB3, SMARCAL1, or HTLF as described in C. (E) Quantification of q arm fragile telomeres detected by FISH in BlmF/F MEFs ± Cre (96 h) after CRISPR/Cas9 targeting of Slx4 with three different sgRNAs. Control cells were infected with an sgRNA targeting Luciferase (sgLuc). The relative level of SLX4 mRNA normalized to GAPDH was determined by RT-qPCR and compared with the sgLuc sample (set to 100). (F) Western blot analysis of SLX1 after CRISPR/Cas9 targeting of Slx1 with three different sgRNAs. γ-Tubulin serves as the loading control. (G) Quantification of q arm fragile telomeres detected by FISH in BlmF/F MEFs ± Cre (96 h) after CRISPR/Cas9 targeting of Slx1 with three different sgRNAs as in F. (H) Western blot analysis of the expression of FLAG-SLX4 and various mutants in BlmF/F MEFs with γ-Tubulin as the loading control. (I) Quantification of q arm fragile telomeres detected by FISH in BlmF/F MEFs + Cre (96 h) expressing empty vector (−), sgRNA-resistant WT FLAG-SLX4 or various mutants with CRISPR/Cas9 targeting of Luc or Slx4. (J) PLA foci (red) of TRF1 and γH2AX detected in BlmF/F MEFs ± Cre (96 h). (K) Quantification of PLA foci as in J in BlmF/F MEFs ± Cre (96 h) with CRISPR/Cas9 targeting of Luc, Slx4, or Slx1. Data are means ± SD of four independent experiments of >100 nuclei each. P-values were from paired two-tailed t-tests. (*) P ≤ 0.05. (L) PLA foci (red) of FLAG-TRF1 and 53BP1 detected in BlmF/F MEFs ± Cre (96 h). (M) Quantification of FLAG-TRF1/53BP1 PLA foci in BlmF/F MEFs ± Cre (96 h) with CRISPR/Cas9 targeting of Luc, Slx4, or Slx1. Data are means ± SD of three independent experiments of >100 nuclei each. For the fragile telomere analyses in D, E, G, and I, data are means ± SD from three independent experiments with ∼2000 telomeres analyzed per experiment. All P-values except for the ones in K were derived from unpaired two-tailed t-tests. (***) P ≤ 0.001, (**) P ≤ 0.01, (*) P ≤ 0.05, (n.s.) P > 0.05.

Journal: Genes & Development

Article Title: Break-induced replication promotes fragile telomere formation

doi: 10.1101/gad.328575.119

Figure Lengend Snippet: SLX1/SLX4 contribute to fragile telomere formation in Blm-deficient cells. (A) Western blot analysis of BLM in BlmF/F MEFs ± Cre (96 h). γ-Tubulin serves as the loading control. (B) Telomere FISH on metaphase spreads of BlmF/F MEFs ± Cre (96 h) with Cy3-[CCCTAA]3 probes (green) and DAPI staining (red). Fragile telomeres are marked by an asterisk. (C) Knockdown of ZRANB3, SMARCAL1, and HTLF with shRNAs (6 d) in BlmF/F MEFs verified by Western blotting. Cells infected with an shRNA targeting Luciferase (shLuc) were used as the control. γ-Tubulin serves as the loading control and an asterisk marks a nonspecific band detected by the HLTF antibody. (D) Quantification of fragile telomeres detected by FISH (q arms only) in BlmF/F MEFs ± Cre (96 h) with shRNAs targeting Luc, ZRANB3, SMARCAL1, or HTLF as described in C. (E) Quantification of q arm fragile telomeres detected by FISH in BlmF/F MEFs ± Cre (96 h) after CRISPR/Cas9 targeting of Slx4 with three different sgRNAs. Control cells were infected with an sgRNA targeting Luciferase (sgLuc). The relative level of SLX4 mRNA normalized to GAPDH was determined by RT-qPCR and compared with the sgLuc sample (set to 100). (F) Western blot analysis of SLX1 after CRISPR/Cas9 targeting of Slx1 with three different sgRNAs. γ-Tubulin serves as the loading control. (G) Quantification of q arm fragile telomeres detected by FISH in BlmF/F MEFs ± Cre (96 h) after CRISPR/Cas9 targeting of Slx1 with three different sgRNAs as in F. (H) Western blot analysis of the expression of FLAG-SLX4 and various mutants in BlmF/F MEFs with γ-Tubulin as the loading control. (I) Quantification of q arm fragile telomeres detected by FISH in BlmF/F MEFs + Cre (96 h) expressing empty vector (−), sgRNA-resistant WT FLAG-SLX4 or various mutants with CRISPR/Cas9 targeting of Luc or Slx4. (J) PLA foci (red) of TRF1 and γH2AX detected in BlmF/F MEFs ± Cre (96 h). (K) Quantification of PLA foci as in J in BlmF/F MEFs ± Cre (96 h) with CRISPR/Cas9 targeting of Luc, Slx4, or Slx1. Data are means ± SD of four independent experiments of >100 nuclei each. P-values were from paired two-tailed t-tests. (*) P ≤ 0.05. (L) PLA foci (red) of FLAG-TRF1 and 53BP1 detected in BlmF/F MEFs ± Cre (96 h). (M) Quantification of FLAG-TRF1/53BP1 PLA foci in BlmF/F MEFs ± Cre (96 h) with CRISPR/Cas9 targeting of Luc, Slx4, or Slx1. Data are means ± SD of three independent experiments of >100 nuclei each. For the fragile telomere analyses in D, E, G, and I, data are means ± SD from three independent experiments with ∼2000 telomeres analyzed per experiment. All P-values except for the ones in K were derived from unpaired two-tailed t-tests. (***) P ≤ 0.001, (**) P ≤ 0.01, (*) P ≤ 0.05, (n.s.) P > 0.05.

Article Snippet: Mouse Slx4 and Slx1 cDNAs were purchased from Origene and cloned into pWZL-FLAG-Hygro vector. sgRNA-resistant Slx4 (ATCTGAAACAATGCGCCGTC in place of sgRNA#2 ACTTGAAGCAGTGTGCGGTG) and Slx1 (CGGAAAAAGGGAGGTGCCTGG in place of sgRNA#1 GCAAGAAAGGTGGAGCATGG) were generated by site-directed mutagenesis using PCR.

Techniques: Western Blot, Staining, Infection, shRNA, Luciferase, CRISPR, Quantitative RT-PCR, Expressing, Plasmid Preparation, Two Tailed Test, Derivative Assay

Fragile telomeres of Blm-deficient cells arise from conservative replication. (A) Model for BIR-mediated fragile telomere formation and their removal after CO-FISH. (B) Schematic and images of CO-FISH on cells cultured in the presence of BrdU and BrdC for 16 or 26 h. The substituted DNA strands are removed by treatment with Hoechst 33258, UV, and exonuclease III. Telomeres replicated by leading-strand DNA synthesis were hybridized [TTAGGG]3 (green) and lagging-strand telomeres with [CCCTAA]3 (red). Cells labeled for 16 h (one S phase) show two signals per chromosome end, whereas cells labeled for 26 h (two S phases) show one signal per chromosome end, indicating that telomeres lacking a parental strand are poorly detected by CO-FISH. (C) Comparison of telomere FISH and CO-FISH performed on parallel metaphase spreads of BlmF/F MEFs + Cre (96 h). FISH was performed with [CCCTAA]3 (green), CO-FISH was done with [TTAGGG]3 (green) and [CCCTAA]3 (red), and DNA was stained with DAPI (blue). Fragile telomeres are marked by an asterisk. (D) Quantification of q arm fragile telomeres in BlmF/F ± Cre cells (96 h) detected by FISH and CO-FISH on the same samples derived from BrdU/BrdC-labeled cells. (E) Quantification of leading- and lagging-end q arm telomeres using CO-FISH as in D. Note that a sample with 6% lagging fragile telomeres and 2% leading fragile telomeres will show an average of 4% fragile telomeres when both sisters are scored (as is the case in D). (F) Quantification of leading- and lagging-end q arm fragile telomeres using CO-FISH in BlmF/F MEFs ± Cre (96 h) with CRISPR/Cas9 targeting of Luc, Slx4, or Slx1. (G) Quantification of leading- and lagging-end q arm fragile telomeres using CO-FISH in BlmF/F MEFs ± Cre (96 h) with shRNAs targeting Luc or Pold3. For all fragile telomere analyses in this figure, data are means ± SD of three independent experiments of ∼2000 telomeres analyzed per experiment. All P-values in this figure were derived from two-tailed unpaired t-test. (***) P ≤ 0.001, (**) P ≤ 0.01, (n.s.) P > 0.05.

Journal: Genes & Development

Article Title: Break-induced replication promotes fragile telomere formation

doi: 10.1101/gad.328575.119

Figure Lengend Snippet: Fragile telomeres of Blm-deficient cells arise from conservative replication. (A) Model for BIR-mediated fragile telomere formation and their removal after CO-FISH. (B) Schematic and images of CO-FISH on cells cultured in the presence of BrdU and BrdC for 16 or 26 h. The substituted DNA strands are removed by treatment with Hoechst 33258, UV, and exonuclease III. Telomeres replicated by leading-strand DNA synthesis were hybridized [TTAGGG]3 (green) and lagging-strand telomeres with [CCCTAA]3 (red). Cells labeled for 16 h (one S phase) show two signals per chromosome end, whereas cells labeled for 26 h (two S phases) show one signal per chromosome end, indicating that telomeres lacking a parental strand are poorly detected by CO-FISH. (C) Comparison of telomere FISH and CO-FISH performed on parallel metaphase spreads of BlmF/F MEFs + Cre (96 h). FISH was performed with [CCCTAA]3 (green), CO-FISH was done with [TTAGGG]3 (green) and [CCCTAA]3 (red), and DNA was stained with DAPI (blue). Fragile telomeres are marked by an asterisk. (D) Quantification of q arm fragile telomeres in BlmF/F ± Cre cells (96 h) detected by FISH and CO-FISH on the same samples derived from BrdU/BrdC-labeled cells. (E) Quantification of leading- and lagging-end q arm telomeres using CO-FISH as in D. Note that a sample with 6% lagging fragile telomeres and 2% leading fragile telomeres will show an average of 4% fragile telomeres when both sisters are scored (as is the case in D). (F) Quantification of leading- and lagging-end q arm fragile telomeres using CO-FISH in BlmF/F MEFs ± Cre (96 h) with CRISPR/Cas9 targeting of Luc, Slx4, or Slx1. (G) Quantification of leading- and lagging-end q arm fragile telomeres using CO-FISH in BlmF/F MEFs ± Cre (96 h) with shRNAs targeting Luc or Pold3. For all fragile telomere analyses in this figure, data are means ± SD of three independent experiments of ∼2000 telomeres analyzed per experiment. All P-values in this figure were derived from two-tailed unpaired t-test. (***) P ≤ 0.001, (**) P ≤ 0.01, (n.s.) P > 0.05.

Article Snippet: Mouse Slx4 and Slx1 cDNAs were purchased from Origene and cloned into pWZL-FLAG-Hygro vector. sgRNA-resistant Slx4 (ATCTGAAACAATGCGCCGTC in place of sgRNA#2 ACTTGAAGCAGTGTGCGGTG) and Slx1 (CGGAAAAAGGGAGGTGCCTGG in place of sgRNA#1 GCAAGAAAGGTGGAGCATGG) were generated by site-directed mutagenesis using PCR.

Techniques: Cell Culture, DNA Synthesis, Labeling, Comparison, Staining, Derivative Assay, CRISPR, Two Tailed Test

Primers used for DNA methylation analysis.

Journal: Cells

Article Title: From Differential DNA Methylation in COPD to Mitochondria: Regulation of AHRR Expression Affects Airway Epithelial Response to Cigarette Smoke

doi: 10.3390/cells11213423

Figure Lengend Snippet: Primers used for DNA methylation analysis.

Article Snippet: AHRR , Hs01005075_m1.

Techniques: DNA Methylation Assay, Sequencing, Amplification

Taqman probes.

Journal: Cells

Article Title: From Differential DNA Methylation in COPD to Mitochondria: Regulation of AHRR Expression Affects Airway Epithelial Response to Cigarette Smoke

doi: 10.3390/cells11213423

Figure Lengend Snippet: Taqman probes.

Article Snippet: AHRR , Hs01005075_m1.

Techniques:

Association of AHRR DNA methylation with COPD in never smokers and smokers from Lifelines. Forest plot of the association between COPD (defined as FEV1/FVC < 70%) and DNA methylation at CpG-sites cg05575921 and cg21161138 in the gene AHRR in whole blood from 658 current smokers and 903 never smokers from the Lifelines DNA methylation cohort study. Beta indicates the effect estimate, i.e., the difference between COPD and control subjects. A negative value points towards a negative association.

Journal: Cells

Article Title: From Differential DNA Methylation in COPD to Mitochondria: Regulation of AHRR Expression Affects Airway Epithelial Response to Cigarette Smoke

doi: 10.3390/cells11213423

Figure Lengend Snippet: Association of AHRR DNA methylation with COPD in never smokers and smokers from Lifelines. Forest plot of the association between COPD (defined as FEV1/FVC < 70%) and DNA methylation at CpG-sites cg05575921 and cg21161138 in the gene AHRR in whole blood from 658 current smokers and 903 never smokers from the Lifelines DNA methylation cohort study. Beta indicates the effect estimate, i.e., the difference between COPD and control subjects. A negative value points towards a negative association.

Article Snippet: AHRR , Hs01005075_m1.

Techniques: DNA Methylation Assay

DNA methylation levels and mRNA expression of AHRR and the correlation of AHRR mRNA levels with AHRR DNA methylation or AHR expression in airway epithelial cells (AECs). AECs from 8 ex-smoking non-COPD controls (CTR) and 14 COPD (GOLD stage II-IV) patients were cultured until confluence, hormonally deprived overnight and incubated in medium with/without 7.5% CSE for 24 h. DNA and RNA were isolated for assessment of DNA methylation and mRNA expression levels. DNA methylation was assessed at CpG-sites cg05575921 ( A ) and cg21161138 ( B ) of AHRR by pyrosequencing. Samples that did not pass the pyrosequencing quality control were excluded. AHRR mRNA expression was assessed by qPCR ( C ), related to the expression of housekeeping genes B2M and PPIA and expressed as 2 − ΔCt . Correlation between AHRR mRNA expression and DNA methylation levels of cg05575921 ( D ) or cg21161138 ( E ) in AECs exposed to 7.5% CSE or medium control (no CSE) from non-COPD controls and COPD patients. The correlation of mRNA expression between AHRR and AHR ( F ) in non-exposed AECs from non-COPD controls and COPD patients. Differences between CTR and COPD were tested using the Mann–Whitney test, differences between no CSE and CSE were tested using the Wilcoxon rank-sum test and correlations were tested using Spearman correlation test. p -values and median levels are indicated. In COPD groups, the empty symbols indicate GOLD stage II and III patients, and the filled symbols indicate GOLD stage IV COPD patients.

Journal: Cells

Article Title: From Differential DNA Methylation in COPD to Mitochondria: Regulation of AHRR Expression Affects Airway Epithelial Response to Cigarette Smoke

doi: 10.3390/cells11213423

Figure Lengend Snippet: DNA methylation levels and mRNA expression of AHRR and the correlation of AHRR mRNA levels with AHRR DNA methylation or AHR expression in airway epithelial cells (AECs). AECs from 8 ex-smoking non-COPD controls (CTR) and 14 COPD (GOLD stage II-IV) patients were cultured until confluence, hormonally deprived overnight and incubated in medium with/without 7.5% CSE for 24 h. DNA and RNA were isolated for assessment of DNA methylation and mRNA expression levels. DNA methylation was assessed at CpG-sites cg05575921 ( A ) and cg21161138 ( B ) of AHRR by pyrosequencing. Samples that did not pass the pyrosequencing quality control were excluded. AHRR mRNA expression was assessed by qPCR ( C ), related to the expression of housekeeping genes B2M and PPIA and expressed as 2 − ΔCt . Correlation between AHRR mRNA expression and DNA methylation levels of cg05575921 ( D ) or cg21161138 ( E ) in AECs exposed to 7.5% CSE or medium control (no CSE) from non-COPD controls and COPD patients. The correlation of mRNA expression between AHRR and AHR ( F ) in non-exposed AECs from non-COPD controls and COPD patients. Differences between CTR and COPD were tested using the Mann–Whitney test, differences between no CSE and CSE were tested using the Wilcoxon rank-sum test and correlations were tested using Spearman correlation test. p -values and median levels are indicated. In COPD groups, the empty symbols indicate GOLD stage II and III patients, and the filled symbols indicate GOLD stage IV COPD patients.

Article Snippet: AHRR , Hs01005075_m1.

Techniques: DNA Methylation Assay, Expressing, Cell Culture, Incubation, Isolation, MANN-WHITNEY

Induction of AHRR mRNA expression in 16HBE cells upon CSE exposure and validation of the AHRR CRISPR/Cas9 knockout. 16HBE cells ( n = 7) were seeded in duplicate, grown to confluence, serum deprived overnight and exposed to 10% and 20% CSE or medium control for 6 h. Cells were harvested for RNA isolation. mRNA Expression of AHRR was measured by qPCR, related to the expression of housekeeping genes B2M and PPIA and expressed as 2 − ΔΔCt ( A ). AHRR knockout (KO) cells were generated using CRISPR/Cas9 together with 16HBE wild-type (WT) cells and assessed by Sanger sequencing. The base pair deletion is visualized by the chromatograms of the Sanger-sequenced 16HBE WT and AHRR KO cells as well as the sequence of the guide RNA (gRNA) ( B ). DNA sequence and amino acid translation of WT and AHRR KO in which the base pair deletion in the AHRR KO is indicated by a hyphen and a red circle. Stop codons are indicated by an asterisk and highlighted by red circles ( C ). Indel spectrum produced by Tracking of Indels by Decomposition (TIDE) analysis shows the base pair deletion ( D ). 16HBE WT or AHRR KO cells ( n = 6/group) were seeded in duplicate, serum deprived overnight and exposed to 10% and 20% CSE or medium control (no CSE) for 6 h. Cells were harvested for RNA isolation AHR mRNA expression was measured by qPCR, related to the expression of housekeeping genes B2M and PPIA and expressed as 2 − ΔΔCt ( E ) or fold change (2 − ΔΔCt ) with the CSE groups normalized to their medium controls ( F ). Median levels are indicated. Differences between treatment conditions were tested with the Wilcoxon rank-sum test and the difference between WT and AHRR KO at baseline was tested with Mann–Whitney test. p -values are as indicated between the groups.

Journal: Cells

Article Title: From Differential DNA Methylation in COPD to Mitochondria: Regulation of AHRR Expression Affects Airway Epithelial Response to Cigarette Smoke

doi: 10.3390/cells11213423

Figure Lengend Snippet: Induction of AHRR mRNA expression in 16HBE cells upon CSE exposure and validation of the AHRR CRISPR/Cas9 knockout. 16HBE cells ( n = 7) were seeded in duplicate, grown to confluence, serum deprived overnight and exposed to 10% and 20% CSE or medium control for 6 h. Cells were harvested for RNA isolation. mRNA Expression of AHRR was measured by qPCR, related to the expression of housekeeping genes B2M and PPIA and expressed as 2 − ΔΔCt ( A ). AHRR knockout (KO) cells were generated using CRISPR/Cas9 together with 16HBE wild-type (WT) cells and assessed by Sanger sequencing. The base pair deletion is visualized by the chromatograms of the Sanger-sequenced 16HBE WT and AHRR KO cells as well as the sequence of the guide RNA (gRNA) ( B ). DNA sequence and amino acid translation of WT and AHRR KO in which the base pair deletion in the AHRR KO is indicated by a hyphen and a red circle. Stop codons are indicated by an asterisk and highlighted by red circles ( C ). Indel spectrum produced by Tracking of Indels by Decomposition (TIDE) analysis shows the base pair deletion ( D ). 16HBE WT or AHRR KO cells ( n = 6/group) were seeded in duplicate, serum deprived overnight and exposed to 10% and 20% CSE or medium control (no CSE) for 6 h. Cells were harvested for RNA isolation AHR mRNA expression was measured by qPCR, related to the expression of housekeeping genes B2M and PPIA and expressed as 2 − ΔΔCt ( E ) or fold change (2 − ΔΔCt ) with the CSE groups normalized to their medium controls ( F ). Median levels are indicated. Differences between treatment conditions were tested with the Wilcoxon rank-sum test and the difference between WT and AHRR KO at baseline was tested with Mann–Whitney test. p -values are as indicated between the groups.

Article Snippet: AHRR , Hs01005075_m1.

Techniques: Expressing, CRISPR, Knock-Out, Isolation, Generated, Sequencing, Produced, MANN-WHITNEY

AHRR knockout attenuates the proliferation of 16HBE cells without altering AHR-related genes. 16HBE wild-type (WT) or AHRR knockout (KO) cells ( n = 6) were seeded in triplicate in 96-wells plates, and the cell proliferation was measured using MTS assay at day 2, day 4 and day 6 after seeding. Cell proliferation rate of WT and AHRR KO cells is shown and depicted as median with interquartile range ( A ). 16HBE WT and AHRR KO cells ( n = 6) were seeded in duplicate in 24-well plates, grown to confluence, serum-deprived overnight, incubated in medium with/without 10% CSE for 6 h and harvested for isolation of RNA. The mRNA levels of P27 ( B ), P21 ( C ), BAX ( D ) and CYP1A1 ( E ) were determined using qPCR, related to the expression of housekeeping genes B2M and PPIA and expressed as 2 −ΔΔCt . Median levels are indicated. The differences between WT and AHRR KO were tested using the Mann–Whitney test. p -values are as indicated between the groups.

Journal: Cells

Article Title: From Differential DNA Methylation in COPD to Mitochondria: Regulation of AHRR Expression Affects Airway Epithelial Response to Cigarette Smoke

doi: 10.3390/cells11213423

Figure Lengend Snippet: AHRR knockout attenuates the proliferation of 16HBE cells without altering AHR-related genes. 16HBE wild-type (WT) or AHRR knockout (KO) cells ( n = 6) were seeded in triplicate in 96-wells plates, and the cell proliferation was measured using MTS assay at day 2, day 4 and day 6 after seeding. Cell proliferation rate of WT and AHRR KO cells is shown and depicted as median with interquartile range ( A ). 16HBE WT and AHRR KO cells ( n = 6) were seeded in duplicate in 24-well plates, grown to confluence, serum-deprived overnight, incubated in medium with/without 10% CSE for 6 h and harvested for isolation of RNA. The mRNA levels of P27 ( B ), P21 ( C ), BAX ( D ) and CYP1A1 ( E ) were determined using qPCR, related to the expression of housekeeping genes B2M and PPIA and expressed as 2 −ΔΔCt . Median levels are indicated. The differences between WT and AHRR KO were tested using the Mann–Whitney test. p -values are as indicated between the groups.

Article Snippet: AHRR , Hs01005075_m1.

Techniques: Knock-Out, MTS Assay, Incubation, Isolation, Expressing, MANN-WHITNEY

AHRR knockout enhances CSE-induced mitochondrial damage in 16HBE cells. 16HBE wild-type (WT) and AHRR knockout (KO) cells were seeded in duplicate, grown to confluence, serum-deprived overnight and incubated in medium with/without 20% CSE for 4 h before staining with TMRE and mitochondrial membrane potential (Δψm) was measured using flow cytometry ( n = 7). For the isolation of RNA, the cells were incubated with medium control or 10% CSE for 6 h before harvesting ( n = 6). Baseline levels of Δψm in 16HBE WT and AHRR KO cells as measured by TMRE assay ( A ). Fold change in Δψm levels upon CSE exposure compared to unexposed cells in WT and AHRR KO, respectively ( B ). Gating strategy of Δψm measurement using flow cytometry of a representative experiment is shown ( C ). As demonstrated in the left panel, live cells were selected based on cell size (forward and side scatter); as indicated in the middle panel, single cells were selected on basis of similar size on the forward and side scatter; as indicated in the right panel, TMRE positive cells were gated (intensity above 10 7 in the PE channel). mRNA levels of CYP1A1 ( D ) and HMOX1 ( E ) were measured using qPCR, related to the expression of housekeeping genes B2M and PPIA and expressed as 2 − ΔΔCt . Median levels are indicated. CSE groups were normalized to their medium controls. Differences between WT and AHRR KO were tested with the Mann–Whitney test, and differences between medium and CSE were tested with Wilcoxon rank-sum test. p -values are as indicated between the groups.

Journal: Cells

Article Title: From Differential DNA Methylation in COPD to Mitochondria: Regulation of AHRR Expression Affects Airway Epithelial Response to Cigarette Smoke

doi: 10.3390/cells11213423

Figure Lengend Snippet: AHRR knockout enhances CSE-induced mitochondrial damage in 16HBE cells. 16HBE wild-type (WT) and AHRR knockout (KO) cells were seeded in duplicate, grown to confluence, serum-deprived overnight and incubated in medium with/without 20% CSE for 4 h before staining with TMRE and mitochondrial membrane potential (Δψm) was measured using flow cytometry ( n = 7). For the isolation of RNA, the cells were incubated with medium control or 10% CSE for 6 h before harvesting ( n = 6). Baseline levels of Δψm in 16HBE WT and AHRR KO cells as measured by TMRE assay ( A ). Fold change in Δψm levels upon CSE exposure compared to unexposed cells in WT and AHRR KO, respectively ( B ). Gating strategy of Δψm measurement using flow cytometry of a representative experiment is shown ( C ). As demonstrated in the left panel, live cells were selected based on cell size (forward and side scatter); as indicated in the middle panel, single cells were selected on basis of similar size on the forward and side scatter; as indicated in the right panel, TMRE positive cells were gated (intensity above 10 7 in the PE channel). mRNA levels of CYP1A1 ( D ) and HMOX1 ( E ) were measured using qPCR, related to the expression of housekeeping genes B2M and PPIA and expressed as 2 − ΔΔCt . Median levels are indicated. CSE groups were normalized to their medium controls. Differences between WT and AHRR KO were tested with the Mann–Whitney test, and differences between medium and CSE were tested with Wilcoxon rank-sum test. p -values are as indicated between the groups.

Article Snippet: AHRR , Hs01005075_m1.

Techniques: Knock-Out, Incubation, Staining, Flow Cytometry, Isolation, Expressing, MANN-WHITNEY

AHRR knockout enhances CSE-induced cell apoptosis/necroptosis without altering cytochrome C and dsDNA levels. 16HBE wild-type (WT) and AHRR knockout (KO) cells ( n = 6/group) were seeded in duplicate, grown to confluence and serum-deprived overnight. For the measurement of cytochrome C and dsDNA levels, the cells were either incubated in medium with/without 20% CSE for 24 h and cell-free supernatant was collected. For the Annexin V/PI measurement, the cells were incubated in medium with/without 20% CSE for 4 h before Annexin V/PI staining was performed and measured using flow cytometry. Cytochrome C ( A ) and dsDNA ( B ) in cell-free supernatants were measured and CSE groups were normalized to their medium controls. A stack histogram of the percentages of live, early apoptotic, late apoptotic/necroptotic and necrotic cells in the single cell population (medians with upper interquartile range) is shown ( C ). Gating strategy of Annexin V/PI staining measurement using flow cytometry of a representative experiment is shown ( D ). As demonstrated in the left panel, live cells were selected based on cell size (forward and side scatter); as indicated in the middle panel, single cells were selected on basis of similar size on the forward and side scatter; and as indicated in the right panel, single cells were divided into 4 quartiles based on the positivity of Annexin V (FITC channel) and PI (PI channel). Necrosis (Q1), PI positive and Annexin V negative; late apoptosis/necroptosis (Q2), positive for both Annexin V and PI; live cells (Q3), negative for both Annexin V and PI; early apoptotic cells (Q4), Annexin V positive and PI negative. Annexin V/PI staining assay is shown as the fold change in percentage of cells upon 20% CSE compared to their respective medium control groups, indicated by the dotted line ( E ). # Indicates a significant difference in the percentage of cells upon 20% CSE exposure compared to medium control groups (no CSE), p < 0.05. The other p -values are as indicated between the WT and KO groups. Median levels are indicated. Differences between CSE and medium were assessed by Wilcoxon rank-sum test and differences between WT and AHRR KO were assessed by Mann–Whitney test.

Journal: Cells

Article Title: From Differential DNA Methylation in COPD to Mitochondria: Regulation of AHRR Expression Affects Airway Epithelial Response to Cigarette Smoke

doi: 10.3390/cells11213423

Figure Lengend Snippet: AHRR knockout enhances CSE-induced cell apoptosis/necroptosis without altering cytochrome C and dsDNA levels. 16HBE wild-type (WT) and AHRR knockout (KO) cells ( n = 6/group) were seeded in duplicate, grown to confluence and serum-deprived overnight. For the measurement of cytochrome C and dsDNA levels, the cells were either incubated in medium with/without 20% CSE for 24 h and cell-free supernatant was collected. For the Annexin V/PI measurement, the cells were incubated in medium with/without 20% CSE for 4 h before Annexin V/PI staining was performed and measured using flow cytometry. Cytochrome C ( A ) and dsDNA ( B ) in cell-free supernatants were measured and CSE groups were normalized to their medium controls. A stack histogram of the percentages of live, early apoptotic, late apoptotic/necroptotic and necrotic cells in the single cell population (medians with upper interquartile range) is shown ( C ). Gating strategy of Annexin V/PI staining measurement using flow cytometry of a representative experiment is shown ( D ). As demonstrated in the left panel, live cells were selected based on cell size (forward and side scatter); as indicated in the middle panel, single cells were selected on basis of similar size on the forward and side scatter; and as indicated in the right panel, single cells were divided into 4 quartiles based on the positivity of Annexin V (FITC channel) and PI (PI channel). Necrosis (Q1), PI positive and Annexin V negative; late apoptosis/necroptosis (Q2), positive for both Annexin V and PI; live cells (Q3), negative for both Annexin V and PI; early apoptotic cells (Q4), Annexin V positive and PI negative. Annexin V/PI staining assay is shown as the fold change in percentage of cells upon 20% CSE compared to their respective medium control groups, indicated by the dotted line ( E ). # Indicates a significant difference in the percentage of cells upon 20% CSE exposure compared to medium control groups (no CSE), p < 0.05. The other p -values are as indicated between the WT and KO groups. Median levels are indicated. Differences between CSE and medium were assessed by Wilcoxon rank-sum test and differences between WT and AHRR KO were assessed by Mann–Whitney test.

Article Snippet: AHRR , Hs01005075_m1.

Techniques: Knock-Out, Incubation, Staining, Flow Cytometry, MANN-WHITNEY